pyromark q96 md system (Qiagen)
Qiagen is a verified supplier 
Qiagen manufactures this product 
90
Structured Review
Qiagen
pyromark q96 md system
Pyromark Q96 Md System, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pyromark+md+system/pyromark+q24/pmc10514224__S0007125023000132sup001-6-5-9
Average 90 stars, based on 1 article reviews
Pyromark Q96 Md System, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pyromark+md+system/pyromark+q24/pmc10514224__S0007125023000132sup001-6-5-9
Average 90 stars, based on 1 article reviews
pyromark q96 md system - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Sequencing:Article Title: DNA methylation and genotype specific biomarker for predicting post-traumatic stress disorder Article Snippet: Nested PCR amplifications were performed with a standard PCR protocol in 25 ml volume reactions containing 3-4 μl of sodium-bisulfate-treated DNA, 0.2 uM primers, and master mix containing Taq DNA polymerase (Sigma-Aldrich, St. Louis, Missouri, USA). .. Primer sequences for the SKA2 3′UTR CpG and those two CpGs analyzed upstream can be found included: TABLE 1 SKA2 pyrosequencing primer sequences Primer Name Primer Sequence 5′-3′ SKA2 3′UTR SK42_Forward Outside GAGAAATAAGTTATATTTTAGTATTAGATA SKA2_Fo (SEQ ID NO: 1) SK42_Reverse Outside AAAATAATACAATCTAATTTTTCTCCCT SKA2_Ro (SEQ ID NO: 2) SK42_Forward Inside biotin-GAGATGGTTTTGGGATGTGATG SKA2_Fib (SEQ ID NO: 3) SK42_Reverse Inside TAACTAAAAACAAAACCACTTTTAATACTA SKA2_Ri (SEQ ID NO: 4) SK42_Pyrosequencing Primer ATTATAATCTCTCCATAATACTACC SKA2_Pyro (SEQ ID NO: 5) SKA2_upstream SK42_upstream_Forward Outside AATTGTTTTGTTTAGTTTGAATATTTTAAG SKA2_upstream_Fo (SEQ ID NO: 6) SK42_upstream_Reverse Outside TATCTAATACTAAAATATAACTTATTTCTC SKA2_upstream_Ro (SEQ ID NO: 7) SK42_upstream_Forward Inside TGTTTAGGTTGGAATGTAGTGGTA SKA2 upstream_Fib (SEQ ID NO: 8) SK42_upstream_Reverse Inside CCTAATCAAAATAATAAAACCCCATC SKA2_upstream_Ri (SEQ ID NO: 9) SK42_upstream_Pyrosequencing Primer CTCTACTAAAAATACAAAAAAATAACC SKA2_upstream_Pyro (SEQ ID NO: 10) PCR amplicons were processed for pyrosequencing analysis according to the manufacturer's standard protocol (Qiagen, Gaithersburg, MD, USA) using a Article Title: Association between toxic and essential metals in blood and global DNA methylation among electronic waste workers in Agbogbloshie, Ghana. Article Snippet: Aberrant global DNA methylation status is a known biomarker for increased disease risk, especially cancer.. There is little published data on the association between toxic and essential metal mixtures and global DNA methylation in electronic waste (e-waste) workers.. We aimed to establish the association between toxic and essential metals in blood and the effect of their interactions on global DNA methylation among e-waste recyclers and a reference group in Ghana. Polymerase Chain Reaction:Article Title: DNA methylation and genotype specific biomarker for predicting post-traumatic stress disorder Article Snippet: Nested PCR amplifications were performed with a standard PCR protocol in 25 ml volume reactions containing 3-4 μl of sodium-bisulfate-treated DNA, 0.2 uM primers, and master mix containing Taq DNA polymerase (Sigma-Aldrich, St. Louis, Missouri, USA). .. Primer sequences for the SKA2 3′UTR CpG and those two CpGs analyzed upstream can be found included: TABLE 1 SKA2 pyrosequencing primer sequences Primer Name Primer Sequence 5′-3′ SKA2 3′UTR SK42_Forward Outside GAGAAATAAGTTATATTTTAGTATTAGATA SKA2_Fo (SEQ ID NO: 1) SK42_Reverse Outside AAAATAATACAATCTAATTTTTCTCCCT SKA2_Ro (SEQ ID NO: 2) SK42_Forward Inside biotin-GAGATGGTTTTGGGATGTGATG SKA2_Fib (SEQ ID NO: 3) SK42_Reverse Inside TAACTAAAAACAAAACCACTTTTAATACTA SKA2_Ri (SEQ ID NO: 4) SK42_Pyrosequencing Primer ATTATAATCTCTCCATAATACTACC SKA2_Pyro (SEQ ID NO: 5) SKA2_upstream SK42_upstream_Forward Outside AATTGTTTTGTTTAGTTTGAATATTTTAAG SKA2_upstream_Fo (SEQ ID NO: 6) SK42_upstream_Reverse Outside TATCTAATACTAAAATATAACTTATTTCTC SKA2_upstream_Ro (SEQ ID NO: 7) SK42_upstream_Forward Inside TGTTTAGGTTGGAATGTAGTGGTA SKA2 upstream_Fib (SEQ ID NO: 8) SK42_upstream_Reverse Inside CCTAATCAAAATAATAAAACCCCATC SKA2_upstream_Ri (SEQ ID NO: 9) SK42_upstream_Pyrosequencing Primer CTCTACTAAAAATACAAAAAAATAACC SKA2_upstream_Pyro (SEQ ID NO: 10) PCR amplicons were processed for pyrosequencing analysis according to the manufacturer's standard protocol (Qiagen, Gaithersburg, MD, USA) using a Article Title: Association between toxic and essential metals in blood and global DNA methylation among electronic waste workers in Agbogbloshie, Ghana. Article Snippet: Aberrant global DNA methylation status is a known biomarker for increased disease risk, especially cancer.. There is little published data on the association between toxic and essential metal mixtures and global DNA methylation in electronic waste (e-waste) workers.. We aimed to establish the association between toxic and essential metals in blood and the effect of their interactions on global DNA methylation among e-waste recyclers and a reference group in Ghana. Software:Article Title: DNA methylation and genotype specific biomarker for predicting post-traumatic stress disorder Article Snippet: Nested PCR amplifications were performed with a standard PCR protocol in 25 ml volume reactions containing 3-4 μl of sodium-bisulfate-treated DNA, 0.2 uM primers, and master mix containing Taq DNA polymerase (Sigma-Aldrich, St. Louis, Missouri, USA). .. Primer sequences for the SKA2 3′UTR CpG and those two CpGs analyzed upstream can be found included: TABLE 1 SKA2 pyrosequencing primer sequences Primer Name Primer Sequence 5′-3′ SKA2 3′UTR SK42_Forward Outside GAGAAATAAGTTATATTTTAGTATTAGATA SKA2_Fo (SEQ ID NO: 1) SK42_Reverse Outside AAAATAATACAATCTAATTTTTCTCCCT SKA2_Ro (SEQ ID NO: 2) SK42_Forward Inside biotin-GAGATGGTTTTGGGATGTGATG SKA2_Fib (SEQ ID NO: 3) SK42_Reverse Inside TAACTAAAAACAAAACCACTTTTAATACTA SKA2_Ri (SEQ ID NO: 4) SK42_Pyrosequencing Primer ATTATAATCTCTCCATAATACTACC SKA2_Pyro (SEQ ID NO: 5) SKA2_upstream SK42_upstream_Forward Outside AATTGTTTTGTTTAGTTTGAATATTTTAAG SKA2_upstream_Fo (SEQ ID NO: 6) SK42_upstream_Reverse Outside TATCTAATACTAAAATATAACTTATTTCTC SKA2_upstream_Ro (SEQ ID NO: 7) SK42_upstream_Forward Inside TGTTTAGGTTGGAATGTAGTGGTA SKA2 upstream_Fib (SEQ ID NO: 8) SK42_upstream_Reverse Inside CCTAATCAAAATAATAAAACCCCATC SKA2_upstream_Ri (SEQ ID NO: 9) SK42_upstream_Pyrosequencing Primer CTCTACTAAAAATACAAAAAAATAACC SKA2_upstream_Pyro (SEQ ID NO: 10) PCR amplicons were processed for pyrosequencing analysis according to the manufacturer's standard protocol (Qiagen, Gaithersburg, MD, USA) using a CpG Methylation Assay:Article Title: DNA methylation and genotype specific biomarker for predicting post-traumatic stress disorder Article Snippet: Nested PCR amplifications were performed with a standard PCR protocol in 25 ml volume reactions containing 3-4 μl of sodium-bisulfate-treated DNA, 0.2 uM primers, and master mix containing Taq DNA polymerase (Sigma-Aldrich, St. Louis, Missouri, USA). .. Primer sequences for the SKA2 3′UTR CpG and those two CpGs analyzed upstream can be found included: TABLE 1 SKA2 pyrosequencing primer sequences Primer Name Primer Sequence 5′-3′ SKA2 3′UTR SK42_Forward Outside GAGAAATAAGTTATATTTTAGTATTAGATA SKA2_Fo (SEQ ID NO: 1) SK42_Reverse Outside AAAATAATACAATCTAATTTTTCTCCCT SKA2_Ro (SEQ ID NO: 2) SK42_Forward Inside biotin-GAGATGGTTTTGGGATGTGATG SKA2_Fib (SEQ ID NO: 3) SK42_Reverse Inside TAACTAAAAACAAAACCACTTTTAATACTA SKA2_Ri (SEQ ID NO: 4) SK42_Pyrosequencing Primer ATTATAATCTCTCCATAATACTACC SKA2_Pyro (SEQ ID NO: 5) SKA2_upstream SK42_upstream_Forward Outside AATTGTTTTGTTTAGTTTGAATATTTTAAG SKA2_upstream_Fo (SEQ ID NO: 6) SK42_upstream_Reverse Outside TATCTAATACTAAAATATAACTTATTTCTC SKA2_upstream_Ro (SEQ ID NO: 7) SK42_upstream_Forward Inside TGTTTAGGTTGGAATGTAGTGGTA SKA2 upstream_Fib (SEQ ID NO: 8) SK42_upstream_Reverse Inside CCTAATCAAAATAATAAAACCCCATC SKA2_upstream_Ri (SEQ ID NO: 9) SK42_upstream_Pyrosequencing Primer CTCTACTAAAAATACAAAAAAATAACC SKA2_upstream_Pyro (SEQ ID NO: 10) PCR amplicons were processed for pyrosequencing analysis according to the manufacturer's standard protocol (Qiagen, Gaithersburg, MD, USA) using a Amplification:Article Title: Association between toxic and essential metals in blood and global DNA methylation among electronic waste workers in Agbogbloshie, Ghana. Article Snippet: Aberrant global DNA methylation status is a known biomarker for increased disease risk, especially cancer.. There is little published data on the association between toxic and essential metal mixtures and global DNA methylation in electronic waste (e-waste) workers.. We aimed to establish the association between toxic and essential metals in blood and the effect of their interactions on global DNA methylation among e-waste recyclers and a reference group in Ghana. Methylation:Article Title: Association between toxic and essential metals in blood and global DNA methylation among electronic waste workers in Agbogbloshie, Ghana. Article Snippet: Aberrant global DNA methylation status is a known biomarker for increased disease risk, especially cancer.. There is little published data on the association between toxic and essential metal mixtures and global DNA methylation in electronic waste (e-waste) workers.. We aimed to establish the association between toxic and essential metals in blood and the effect of their interactions on global DNA methylation among e-waste recyclers and a reference group in Ghana. |